Locus:chr6:35286005-35286122
Product
Size
Left Primers Right Primers Left GC Right GC Left Tm Right Tm Left
Position
Right
Position
Left Size Right Size
331 AATGTATGCGGTGGTCCCAT GGAGACAGAGCAAGGGAACA 50 55 59.449 59.313 19 349 20 20
390 ACCTGGTGAATGTATGCGG GTTCGGCAAGGCAAGTGTC 52.632 57.895 57.523 59.717 11 400 19 19
362 CTGGTGAATGTATGCGGTGG TTAGTGTCTCAAGGCCCAGG 55 55 58.983 59.016 13 374 20 20
298 GGATCACCTGCCCTTCAAGA ACAGAGCAAGGGAACAAGGA 55 50 59.379 58.86 48 345 20 20
325 GGTGGTCCCATCCTCGAG CAGGGAGACAGAGCAAGGG 66.667 63.158 58.779 59.399 28 352 18 19
312 GTCCCATCCTCGAGCTGG AGAGCAAGGGAACAAGGAAGA 66.667 47.619 59.182 58.942 32 343 18 21
363 GTGAATGTATGCGGTGGTCC ACCCTTAGTGTCTCAAGGCC 55 55 58.986 59.015 16 378 20 20
318 TATGCGGTGGTCCCATCCT GCAAGGGAACAAGGAAGATGT 57.895 47.619 60.384 58.481 23 340 19 21
174 TCCTCGAGCTGGATCACC TTTCCACTCTTACCCATGCTT 61.111 42.857 58.059 57.193 38 211 18 21
167 TCTAAGCATGGGTAAGAGTGGA CCCAGGGAGACAGAGCAA 45.455 61.111 58.28 58.188 188 354 22 18
358 TCTGTACCGTCACCTGGT AGGCCCAGGGAGACAGAG 55.556 66.667 57.063 59.96 0 357 18 18