Locus:chrX:139865339-139866824
Product
Size
Left Primers Right Primers Left GC Right GC Left Tm Right Tm Left
Position
Right
Position
Left Size Right Size
240 AAAGACGCCGGAAGAATCTG CGCCTGGCCTGTTTTGTC 50 61.111 58.273 59.355 111 350 20 18
212 ACAGTCTGGCTCCAAACACT GCCTGGCCTGTTTTGTCTTC 50 55 59.16 59.685 138 349 20 20
215 AGTCTAACAGTCTGGCTCCA TGGCCTGTTTTGTCTTCTTTAAA 50 34.783 57.689 57.076 132 346 20 23
251 AGTCTGGCTCCAAACACTACA CGGCCTCCCAAAGTGCTG 47.619 66.667 58.953 61.058 140 390 21 18
181 CAATACACTGGCGAGGCATG CCTGGCCTGTTTTGTCTTCTTT 55 45.455 59.341 59.305 168 348 20 22
229 TAACAATACACTGGCGAGGC CCTCGGCCTCCCAAAGTG 50 66.667 57.981 60.046 165 393 20 18
210 TGGCTCCAAACACTACACTCT CCACGCCTGGCCTGTTTT 47.619 61.111 58.953 60.912 144 353 21 18