circFAT1(e2)
 GeneFAT1OrganismHuman
 Genome Locuschr4:187627716-187630999:-Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID30419346
 Experimental Method
 Sample TypeTissues and Cell linesComparisonFresh-frozen GC tissues and corresponding normal gastric epithelial tissues were collected from 38 patients
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AACAGAAGAGAACTGGGGCG

Reverse

GATCAGGGTGCCAATGGTGA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Fang, J., Hong, H., Xue, X., Zhu, X., Jiang, L., Qin, M., … Gao, L. (2018). A novel circular RNA, circFAT1(e2), inhibits gastric cancer progression by targeting miR-548g in the cytoplasm and interacting with YBX1 in the nucleus. Cancer Letters. doi:10.1016/j.canlet.2018.10.040