CDR1as/ciRS-7/mmu_circ_0001878
 GeneCdr1OrganismMouse
 Genome Locuschr11:33307958-33309057:+Buildn/a
 DiseaseMyocardial infarctionICD-10 Acute myocardial infarction (I21)
 DBLinkLink to databasePMID26998750
 Experimental Method
 Sample TypeIschemic TissuesComparisonMice were randomly divided into two groups (n = 10 for each) for control vs ischemic condition
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTGTCTCCAGTGTATCGGCG

Reverse

TACTGGCACCACTGGAAACC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Geng, HH, Li, R, Su, YM, Xiao, J, Pan, M, Cai, XX, Ji, XP (2016). The Circular RNA Cdr1as Promotes Myocardial Infarction by Mediating the Regulation of miR-7a on Its Target Genes Expression. PLoS ONE, 11, 3:e0151753.