Circ-104916
 GeneNEK6OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID28761361
 Experimental Method
 Sample TypeTissues and AGS, MKN-28, NCI-N87,MKN-45 and GES-1 Cell linesComparison70 pairs of human GC specimens and their adjacent noncancerous tissue samples
 Method for EstimationqPCR, Western blot, In vitro cell migration and invasion assay etc.PCR Details
 Primers
(Experimented)
Forward

GCTCGGTGACCTTGGTCTGG

Reverse

GCGTGTTGGGATGCCTCTGT

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Li, J, Zhen, L, Zhang, Y, Zhao, L, Liu, H, Cai, D, Chen, H, Yu, J, Qi, X, Li, G (2017). Circ-104916 is downregulated in gastric cancer and suppresses migration and invasion of gastric cancer cells. Onco Targets Ther, 10:3521-3529.