Circ-UBR5
 GeneUBR5OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29944885
 Experimental Method
 Sample TypeTissuesComparison59 samples of NSCLC and paired adjacent lung tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

TAGTGGGCGCAGAAGCGTTGT

Reverse

CTTCTCCAGCCACACCCTCCAC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Qin, M, Wei, G, Sun, X (2018). Circ-UBR5: An exonic circular RNA and novel small nuclear RNA involved in RNA splicing. Biochem. Biophys. Res. Commun., 503, 2:1027-1034.