Circ-ZNF609
 GeneZNF609OrganismHuman
 Genome Locuschr15:64791491-64792365:+Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID30570857
 Experimental Method
 Sample TypeTissuesComparisonTwenty-four paraffin-embedded specimens of colorectal cancer tissues and 36 normal mucosa tissues 5 cm away from the tumor edge
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CAGCGCTCAATCCTTTGGGA

Reverse

GACCTGCCACATTGGTCAGTA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Wu, L, Xia, J, Yang, J, Shi, Y, Xia, H, Xiang, X, Yu, X (2018). Circ-ZNF609 promotes migration of colorectal cancer by inhibiting Gli1 expression via microRNA-150. J BUON, 23, 5:1343-1349.