CircCEP128
 GeneCEP128OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID30134837
 Experimental Method
 Sample TypeTissues and Cell linesComparisonTen pairs of bladder tumor tissues and adjacent bladder tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

ACCCACATCGCTGGTTAGC

Reverse

TCGATCACCTTCTGCTTTCGT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Wu Z, Huang W, Wang X, et al. Circular RNA CEP128 acts as a sponge of miR-145-5p in promoting the bladder cancer progression via regulating SOX11. Mol Med. 2018;24(1):40. Published 2018 Jul 31. doi:10.1186/s10020-018-0039-0