CircPSMC3
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID30777076
 Experimental Method
 Sample TypeTissues, cell lines and blood sampleComparisonOne hundred and-six samples of GC tissues were matched to adjacent normal tissues and 10 ml preoperative blood venous blood were collected
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTTTAGGGTCCCTGCCCTTTG

Reverse

GTGTTGGGCTGGAAGCCATC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Rong, D, Lu, C, Zhang, B, Fu, K, Zhao, S, Tang, W, Cao, H (2019). CircPSMC3 suppresses the proliferation and metastasis of gastric cancer by acting as a competitive endogenous RNA through sponging miR-296-5p. Mol. Cancer, 18, 1:25.