Circ_0078767
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID30507050
 Experimental Method
 Sample TypeTissue and cell linesComparisonNSCLC tissues than that in adjacent tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GCCTAGCTGTCAAGGAGTGG

Reverse

TCTAGAGATGCGCCAACACC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Chen, T, Yang, Z, Liu, C, Wang, L, Yang, J, Chen, L, Li, W (2018). Circ_0078767 suppresses non-small-cell lung cancer by protecting RASSF1A expression via sponging miR-330-3p. Cell Prolif., :e12548.