Circular RNA 100146
 Genen/aOrganismHuman
 Genome Locuschr1:32691771-32692131:+Buildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID30665425
 Experimental Method
 Sample TypeTissue and cell linesComparison40 pairs of matched NSCLC cancer and adjacent tissue samples and cell lines
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GAGCTCAACCAGTATAGTGCC

Reverse

ACATGATGATGTTGCCCCCAA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Chen, L, Nan, A, Zhang, N, Jia, Y, Li, X, Ling, Y, Dai, J, Zhang, S, Yang, Q, Yi, Y, Jiang, Y (2019). Circular RNA 100146 functions as an oncogene through direct binding to miR-361-3p and miR-615-5p in non-small cell lung cancer. Mol. Cancer, 18, 1:13.