Circular RNA ARHGAP26
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID30719998
 Experimental Method
 Sample TypeCell LinesComparisonHuman GC cell lines including HGC-27, AGS, SGC-7901, BGC-823, NCI-N87 and human normal gastric mucosal cells GSE-1 were purchased
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AACAGACTCCATTGAGAAGAGGTT

Reverse

GCCTCCTGAAGCTGAGATTCTT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Wangxia, LV, Fang, Y, Liu, Y, Zhao, Y, Shi, Z, Zhong, H (2019). Circular RNA ARHGAP26 is over-expressed and its downregulation inhibits cell proliferation and promotes cell apoptosis in gastric cancer cells. Saudi J Gastroenterol,