Circular RNA cTFRC
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID30782157
 Experimental Method
 Sample TypeTissue and cell linesComparisonPrimary human BC and paired adjacent normal bladder tissues were obtained from patients
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TGCTGTCCAGCAGCCATAGG

Reverse

TCATTCTGAACTGCCACACAGA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Su, H, Tao, T, Yang, Z, Kang, X, Zhang, X, Kang, D, Wu, S, Li, C (2019). Circular RNA cTFRC acts as the sponge of MicroRNA-107 to promote bladder carcinoma progression. Mol. Cancer, 18, 1:27.