F-circEA
 GeneEML4-ALKOrganismHuman
 Genome LocusExon4(EML4)-Exon22(ALK)Buildhg19
 DiseaseNon-Small cell Lung Cancer tumorigenesisICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29628502
 Experimental Method
 Sample TypeTissues and Hep3B,Huh7 Cell linesComparisonH2228 or H1299 cells , non-small cell lung cancer patients versus control group
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CTGCAAGTGGCTGTGAAGA

Reverse

TCTGTGTATTTGGAGAGGTTGTG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Tan, S, Gou, Q, Pu, W, Guo, C, Yang, Y, Wu, K, Liu, Y, Liu, L, Wei, YQ, Peng, Y (2018). Circular RNA F-circEA produced from EML4-ALK fusion gene as a novel liquid biopsy biomarker for non-small cell lung cancer. Cell Res., 28, 6:693-695.