HIPK3
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseColon CancerICD-10 Malignant neoplasm of Colon, unspecified (C18.9)
 DBLinkLink to databasePMID27892494
 Experimental Method
 Sample TypeDKO-1, Dks-8, and DLD-1 Cell LinesComparisonExosomes were isolated from conditioned medium of DKO-1, Dks-8, and DLD-1 cells
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ATGGCCTCACAAGTCTTGGT

Reverse

TGGCCGACCCAAAGTCTATT

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Dou, Y, Cha, DJ, Franklin, JL, Higginbotham, JN, Jeppesen, DK, Weaver, AM, Prasad, N, Levy, S, Coffey, RJ, Patton, JG, Zhang, B (2016). Circular RNAs are down-regulated in KRAS mutant colon cancer cells and can be transferred to exosomes. Sci Rep, 6:37982.