circad | circRNAs associated with diseases
HRCR
 GenePWWP2AOrganismMouse
 Genome Locuschr11:43518035-43518979:+Buildn/a
 DiseaseHeart failure ICD-10 Congestive heart failure (I50.0)
 DBLinkLink to databasePMID26802132
 Experimental Method
 Sample TypeHeart TissuesComparisonleft ventricles of 2 control, 2 HCM, and 2 DCM individuals, were used for whole transcriptome sequencing
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TCCGGTTTGTCCTTATATTC

Reverse

ACTGGAGAAAATTCGGAGT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Devaux, Y, Creemers, EE, Boon, RA, Werfel, S, Thum, T, Engelhardt, S, Dimmeler, S, Squire, I (2017). Circular RNAs in heart failure. Eur. J. Heart Fail., 19, 6:701-709.