HRCR/mm9-circ-012559/mmu_circ_0000254
 GenePWWP2AOrganismMouse
 Genome Locuschr11:43518035-43518979:+Buildn/a
 DiseaseHypertrophic cardiomyopathyICD-10 Dilated cardiomyopathy (I42)
 DBLinkLink to databasePMID26802132
 Experimental Method
 Sample TypeTissuesComparisonWild type vs Cardiac hypertrophy and heart failure induced mice
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TCCGGTTTGTCCTTATATTC

Reverse

ACTGGAGAAAATTCGGAGT

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Wang, K, Long, B, Liu, F, Wang, JX, Liu, CY, Zhao, B, Zhou, LY, Sun, T, Wang, M, Yu, T, Gong, Y, Liu, J, Dong, YH, Li, N, Li, PF (2016). A circular RNA protects the heart from pathological hypertrophy and heart failure by targeting miR-223. Eur. Heart J., 37, 33:2602-11.