Hsa_circ_0000520
 GeneRPPH1OrganismHuman
 Genome Locuschr14:20811436-20811559:-Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID29103021
 Experimental Method
 Sample TypeMKN-45, BGC-823, MGC- 80 803 and AGS cell lines, Tissue and Blood samplesComparison56 pairs of gastric cancer tissues and corresponding sample
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTCTGAGACTAGGGCCAGAGGC

Reverse

GACATGGGAGTGGAGTGACAGG

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Sun, H, Tang, W, Rong, D, Jin, H, Fu, K, Zhang, W, Liu, Z, Cao, H, Cao, X (2018). Hsa_circ_0000520, a potential new circular RNA biomarker, is involved in gastric carcinoma. Cancer Biomark, 21, 2:299-306.