Hsa_circ_0000673
 GeneRSL1D1OrganismHuman
 Genome Locuschr16:11940357-11940700:-Buildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID30061181
 Experimental Method
 Sample TypeTissue and blood samplesComparisonNormal gastric tissues 3 cm from the margin of resected neoplastic tissues of patients with GC were isolated and confirmed by pathological evaluation. We also collected 38 plasma samples from 14 healthy donors and 24 patients with GC
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

GTATAGGTGGAACAGTCTTAA

Reverse

TTATATTCCTTCTTTAGAGTTTGG

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Chang P, Wang F, Li Y. Hsa_circ_0000673 is down-regulated in gastric cancer and inhibits the proliferation and invasion of tumor cells by targetting miR-532-5p. Biosci Rep. 2018;38(5):BSR20180538. Published 2018 Sep 19. doi:10.1042/BSR20180538