Hsa_circ_0079530
 GeneTWIST1OrganismHuman
 Genome Locuschr7:19155090-19155754:-Buildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29689350
 Experimental Method
 Sample TypeNSCLC cell lines and tissuesComparisonsamples of NSCLC and paired adjacent non-tumorous tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AAATAGATCCGGTGTCTAAATGC

Reverse

TCCATTTTCTCCTTCTCTGGAA

StatisticsFold Change : Upregulated
pvalue : p=0.014
 Citation
Li, J, Wang, J, Chen, Z, Chen, Y, Jin, M (2018). Hsa_circ_0079530 promotes cell proliferation and invasion in non-small cell lung cancer. Gene, 665:1-5.