Hsa_circ_0102533
 GenePCNXOrganismHuman
 Genome Locuschr14:71502781-71522279:n/aBuildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMIDhttp://www.ijcep.com/files/ijcep0077672.pdf
 Experimental Method
 Sample TypeTissues, Whole blood samples and Cell linesComparisonForty-one NSCLC patients and twenty-six healthy subjects
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CCGACCTGTGAAATTCTGGGA

Reverse

GCAGGCTGCAATACTGTGAAG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
n/a