MCF7_circ_000595
 GeneDYNC1H1OrganismHuman
 Genome Locuschr14:102466325-102500789:+Buildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID27829232
 Experimental Method
 Sample TypeTissues and Cell linesComparisonTumour and adjacent tissues and six breast cancer cell lines (BT20, BT474, MCF7, MDAMB468, T47D, and ZR751)
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTACAGATATTGCCAGGACGG

Reverse

TCCTTCAGCCTACCAAACTTC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Nair, AA, Niu, N, Tang, X, Thompson, KJ, Wang, L, Kocher, JP, Subramanian, S, Kalari, KR (2016). Circular RNAs and their associations with breast cancer subtypes. Oncotarget, 7, 49:80967-80979.