MFACR/mm9-circ-016597/mmu_circ_0000290
 GeneSMYD4OrganismMouse
 Genome Locuschr11:75203573-75204729:+Buildn/a
 DiseaseCardiovascular diseaseICD-10 Cardiovascular disease, unspecified (I51.6)
 DBLinkLink to databasePMID28498369
 Experimental Method
 Sample TypeCardiomyocytesComparisoncultured primary cardiomyocytes with those subjected to anoxia/reoxygenation (A/R)
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TCTTACGCACCATCATCTTG

Reverse

GTGTGCAGATTTGACTGTTT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Wang, K, Gan, TY, Li, N, Liu, CY, Zhou, LY, Gao, JN, Chen, C, Yan, KW, Ponnusamy, M, Zhang, YH, Li, PF (2017). Circular RNA mediates cardiomyocyte death via miRNA-dependent upregulation of MTP18 expression. Cell Death Differ., 24, 6:1111-1120.