cir-ITCH
 GeneITCHOrganismHuman
 Genome Locuschr20:33001547-33037285:+Buildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID26110611
 Experimental Method
 Sample TypeTissuesComparisonColorectal Cancer tissues and corresponding paracancerous tissue samples
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GCAGAGGCCAACACTGGAA

Reverse

TCCTTGAAGCTGACTACGCTGAG

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Huang, G, Zhu, H, Shi, Y, Wu, W, Cai, H, Chen, X (2015). cir-ITCH plays an inhibitory role in colorectal cancer by regulating the Wnt/β-catenin pathway. PLoS ONE, 10, 6:e0131225.