circad | circRNAs associated with diseases
circ-102004
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseProstate cancer ICD-10 Malignant neoplasm of prostate (C61)
 DBLinkLink to databasePMID30219508
 Experimental Method
 Sample TypeTissues and Cell linesComparison16 PCa tissues and 6 benign prostatic hyperplasia tissues were collected from patients
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AAACGATTTGAACACTCAGCCA

Reverse

TGTTGGCCTTCTTCCCATTGT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Si-Tu, J., Cai, Y., Feng, T., Yang, D., Yuan, S., Yang, X., … Li, Z. (2018). Upregulated circular RNA circ-102004 that promotes cell proliferation in prostate cancer. International Journal of Biological Macromolecules. doi:10.1016/j.ijbiomac.2018.09.076