circ-BANP
 GeneBANPOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID28103507
 Experimental Method
 Sample TypeTissuesComparisonColorectal Cancer (CRC) cancerous and adjacent normal tissues
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CAGGACGGTCAGCGTCGT

Reverse

GGCACAGCGTTGCTAATGAC

StatisticsFold Change : Upregulated,>25.9-fold
pvalue : p=0.037
 Citation
Zhu, M, Xu, Y, Chen, Y, Yan, F (2017). Circular BANP, an upregulated circular RNA that modulates cell proliferation in colorectal cancer. Biomed. Pharmacother., 88:138-144.