circ-BCRC-3
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID30285878
 Experimental Method
 Sample TypeTissuesComparison47 BC tissues and their adjacent normal bladder tissues were obtained from patients who underwent radical cystectomy for urothelial carcinomas of bladder
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTCAGGAGGGCAGCAGTAGA

Reverse

AACTCAATAGCCATTTCACCAC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Xie F, Li Y, Wang M, et al. Circular RNA BCRC-3 suppresses bladder cancer proliferation through miR-182-5p/p27 axis. Mol Cancer. 2018;17(1):144. Published 2018 Oct 3. doi:10.1186/s12943-018-0892-z