circ-VANGL1
 GeneVANGL1OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID30146736
 Experimental Method
 Sample TypeTissues and Cell linesComparisonBC with 87 cases and 37 cases of normal adjacent tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GTCCGCTCCACCGATGGCGA

Reverse

CTGAACTTCCTCTGTCCGAGT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zeng, Z., Zhou, W., Duan, L., Zhang, J., Lu, X., Jin, L., & Yu, Y. (2018). Circular RNA circ-VANGL1 as a competing endogenous RNA contributes to bladder cancer progression by regulating miR-605-3p/VANGL1 pathway. Journal of Cellular Physiology. doi:10.1002/jcp.27162