circ-ZFR
 GeneZFROrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID29361817
 Experimental Method
 Sample TypeTissuesComparisonGastric Cancer tissues and adjacent tissue samples were collected from 48 GC patients and Human gastric epithelial cell line GES-1 and human GC cell lines AGS, AZ521, and HGC-27
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

AACCACCACAGATTCACTAT

Reverse

AACCACCACAGATTCACTAT

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Liu, T, Liu, S, Xu, Y, Shu, R, Wang, F, Chen, C, Zeng, Y, Luo, H (2018). Circular RNA-ZFR Inhibited Cell Proliferation and Promoted Apoptosis in Gastric Cancer by Sponging miR-130a/miR-107 and Modulating PTEN. Cancer Res Treat, :np page given.