circ0817/CUL5
 GeneCUL5OrganismHuman
 Genome Locuschr11:107916996-107925682:n/aBuildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID25624062
 Experimental Method
 Sample TypeTissues and Cell linesComparisonTumour tissues and matched normal colon mucosa from 31 CRC patients and CRC cell lines (Caco-2, COLO 205, COLO 320HSR, DLD-1, HCT-15, HCT-8, HT-29, LS 174T, SW1116, SW480, SW620)
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ACGTTATTTAGAAACAAGACGAGAATGT

Reverse

TCATCCCAAAGACAGACTGCAT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Bachmayr-Heyda, A, Reiner, AT, Auer, K, Sukhbaatar, N, Aust, S, Bachleitner-Hofmann, T, Mesteri, I, Grunt, TW, Zeillinger, R, Pils, D (2015). Correlation of circular RNA abundance with proliferation--exemplified with colorectal and ovarian cancer, idiopathic lung fibrosis, and normal human tissues. Sci Rep, 5:8057.