circ7374/TNS4
 GeneTNS4OrganismHuman
 Genome Locuschr17:38638380-38638668:n/aBuildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID25624062
 Experimental Method
 Sample TypeTissue and CRC Cell linesComparisonTumour tissues and matched normal colon mucosa from 31 Colorectal Cancer patients
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CAGACGACTCGATGAGGAAGTG

Reverse

CAAACTCACCATCCCACAGAGA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Bachmayr-Heyda, A, Reiner, AT, Auer, K, Sukhbaatar, N, Aust, S, Bachleitner-Hofmann, T, Mesteri, I, Grunt, TW, Zeillinger, R, Pils, D (2015). Correlation of circular RNA abundance with proliferation--exemplified with colorectal and ovarian cancer, idiopathic lung fibrosis, and normal human tissues. Sci Rep, 5:8057.