circDLGAP4/mmu_circ_0001098
 GeneDLGAP4OrganismMouse
 Genome Locuschr2:156571570-156575092:+Buildn/a
 DiseaseAcute Ischemic StrokeICD-10 Cerebral infarction, unspecified (I63.9)
 DBLinkLink to databasePMID29114076
 Experimental Method
 Sample TypePlasma sampleComparison26 stroke patients and 26 non-stroke controls
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TGCCAGATGGACAAGGAGACC

Reverse

CTGGACGGTGACTGAGATGAA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Bai, Y, Zhang, Y, Han, B, Yang, L, Chen, X, Huang, R, Wu, F, Chao, J, Liu, P, Hu, G, Zhang, JH, Yao, H (2018). Circular RNA DLGAP4 Ameliorates Ischemic Stroke Outcomes by Targeting miR-143 to Regulate Endothelial-Mesenchymal Transition Associated with Blood-Brain Barrier Integrity. J. Neurosci., 38, 1:32-50.