circDNMT1
 GeneDNMT1OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID29973691
 Experimental Method
 Sample TypeCell LinesComparisoneight breast cancer cell lines in patients vs normal
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

ACCCTCCTGCCTCAGCCTCCCAAG

Reverse

GTGCTTTTCCTTGTAATCCTGGGG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Du, WW, Yang, W, Li, X, Awan, FM, Yang, Z, Fang, L, Lyu, J, Li, F, Peng, C, Krylov, SN, Xie, Y, Zhang, Y, He, C, Wu, N, Zhang, C, Sdiri, M, Dong, J, Ma, J, Gao, C, Hibberd, S, Yang, BB (2018). A circular RNA circ-DNMT1 enhances breast cancer progression by activating autophagy. Oncogene, 37, 44:5829-5842.