circEPSTI1
 GeneEPSTI1OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID30083277
 Experimental Method
 Sample TypeTissues and Cell linesComparisontumor tissues and their adjacent normal mammal tissues from TNBC patients
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

AAGCTGAAGAAGCTGAACTC

Reverse

GTGTATGCACTTGTGTATTGC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Chen, B, Wei, W, Huang, X, Xie, X, Kong, Y, Dai, D, Yang, L, Wang, J, Tang, H, Xie, X (2018). circEPSTI1 as a Prognostic Marker and Mediator of Triple-Negative Breast Cancer Progression. Theranostics, 8, 14:4003-4015.