circFARSA
 GeneFARSAOrganismHuman
 Genome Locusexon 5-7 of the FARSA geneBuildhg19
 DiseaseNon-Small cell Lung Cancer tumorigenesisICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29722168
 Experimental Method
 Sample TypeTissuesComparisoncancerous and adjacent normal tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

GCTCCTTCTGGAACTTTGAC

Reverse

TTGCTCACCCAGTAGGTCTT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Hang, D, Zhou, J, Qin, N, Zhou, W, Ma, H, Jin, G, Hu, Z, Dai, J, Shen, H (2018). A novel plasma circular RNA circFARSA is a potential biomarker for non-small cell lung cancer. Cancer Med, 7, 6:2783-2791.