circGFRA1/hsa_circ_005239
 GeneGFRA1OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID29037220
 Experimental Method
 Sample TypeTissuesComparisontissue and human mammary epithelial (HME) cell lines (MCF10A and 184A1) and breast cancer cell lines (SKBR3, T47D, BT474, MCF-7, BT-483, BT-20, BT549, MDA-MB-468 and MDA-MB-231
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CCTCCGGGTTAAGAACAAGC

Reverse

CTGGCTGGCAGTTGGTAAAA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
He, R, Liu, P, Xie, X, Zhou, Y, Liao, Q, Xiong, W, Li, X, Li, G, Zeng, Z, Tang, H (2017). circGFRA1 and GFRA1 act as ceRNAs in triple negative breast cancer by regulating miR-34a. J. Exp. Clin. Cancer Res., 36, 1:145.