circHECTD1/mmu_circ_0000375
 GeneHECTD1OrganismMouse
 Genome Locuschr12:52860205-52862157:-Buildn/a
 DiseaseSilicosisICD-10 Pneumoconiosis due to other dust containing silica (J62.8)
 DBLinkLink to databasePMID29290828
 Experimental Method
 Sample TypeRAW264.7 and L929 Cell linesComparisonPrimary cultures of alveolar macrophages from healthy donors and patients and the RAW264.7 macrophage cell line
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

AACTTAGGCGTATTTGGGAGC

Reverse

ACATAGTCGTCATCCCAGGC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Zhou, Z, Jiang, R, Yang, X, Guo, H, Fang, S, Zhang, Y, Cheng, Y, Wang, J, Yao, H, Chao, J (2018). circRNA Mediates Silica-Induced Macrophage Activation Via HECTD1/ZC3H12A-Dependent Ubiquitination. Theranostics, 8, 2:575-592.