circIPO11/hsa_circRNA_103847/hsa_circ_0007915
 GeneIPO11OrganismHuman
 Genome Locuschr5:61745753-61747760:+Buildhg19
 DiseaseLiver cancerICD-10 Malignant neoplasm of Liver, unspecified (C22.9)
 DBLinkLink to databasePMID28727484
 Experimental Method
 Sample TypeTissuesComparisonthree pairs of liver cancer clinical tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CCAGACAGTGGCCTGAACTAA

Reverse

AGTTGGTGATGAGCCCTGC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Ren, S, Xin, Z, Xu, Y, Xu, J, Wang, G (2017). Construction and analysis of circular RNA molecular regulatory networks in liver cancer. Cell Cycle, 16, 22:2204-2211.