circMAN2B2/hsa_circRNA_103595
 GeneMAN2B2OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseLung CancerICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID29550475
 Experimental Method
 Sample TypeTissues and Cell linesComparisonlung tissues and human lung cell line BESA-2B and four lung cancer cell lines(A549, H226, H1299 and H446)
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CAGGACATTTTGCCTCGGTCT3

Reverse

GGTGCGTTGCGTACATGTCTC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Ma, X, Yang, X, Bao, W, Li, S, Liang, S, Sun, Y, Zhao, Y, Wang, J, Zhao, C (2018). Circular RNA circMAN2B2 facilitates lung cancer cell proliferation and invasion via miR-1275/FOXK1 axis. Biochem. Biophys. Res. Commun., 498, 4:1009-1015.