circMTO1
 GeneMTO1OrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID30551873
 Experimental Method
 Sample TypeTissue and cell linesComparisonOne hundred and seventeen bladder cancer tissues and the matched adjacent tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TGCATCAGAGGCTTGGAGAA

Reverse

AAGGAAGGGGTGATCTGACG

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Li, Y., Wan, B., Liu, L., Zhou, L., & Zeng, Q. (2018). Circular RNA circMTO1 suppresses bladder cancer metastasis by sponging miR-221 and inhibiting epithelial-to-mesenchymal transition. Biochemical and Biophysical Research Communications. doi:10.1016/j.bbrc.2018.12.046