circPTK2
 GenePTK2OrganismHuman
 Genome Locuschr8:141856358-141900868:-Buildhg19
 DiseaseBladder CancerICD-10 Malignant neoplasm of Bladder, unspecified (C67.9)
 DBLinkLink to databasePMID29125888
 Experimental Method
 Sample TypeTissuesComparison40 pairs of bladder carcinoma tissue, matched para-carcinoma tissue, and metastatic lymph node tissue
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

ATCATACTGGGAGATGCGGG

Reverse

AGTTGGGGTCAAGGTAAGCA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Xu, ZQ, Yang, MG, Liu, HJ, Su, CQ (2018). Circular RNA hsa_circ_0003221 (circPTK2) promotes the proliferation and migration of bladder cancer cells. J. Cell. Biochem., 119, 4:3317-3325.