circPVT1
 GenePVT1OrganismHuman
 Genome Locuschr8:128902834-128903244:+Buildhg19
 DiseaseNon small cell Lung Cancer ICD-10 Malignant neoplasm of bronchus and lung (C34)
 DBLinkLink to databasePMID30537738
 Experimental Method
 Sample TypeSerum, tissue samples and cell linesComparisonforty-five serum samples, sixty-eight cancer tissues and paired adjacent noncancerous tissues from primary NSCLC patients were collected
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CGACTCTTCCTGGTGAAGCATCTGAT

Reverse

TACTTGAACGAAGCTCCATGCAGC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Li, X, Zhang, Z, Jiang, H, Li, Q, Wang, R, Pan, H, Niu, Y, Liu, F, Gu, H, Fan, X, Gao, J (2018). Circular RNA circPVT1 Promotes Proliferation and Invasion Through Sponging miR-125b and Activating E2F2 Signaling in Non-Small Cell Lung Cancer. Cell. Physiol. Biochem., 51, 5:2324-2340.