circRHOT1
 GeneRHOT1OrganismHuman
 Genome Locusn/aBuildhg19
 DiseasePancreatic cancerICD-10 Malignant neoplasm of Pancreas, unspecified (C25.9)
 DBLinkLink to databasePMID30444423
 Experimental Method
 Sample TypeCell LinesComparisonThe human pancreatic cancer cell lines PATU8988, PATU8988/FU and the immortal human pancreatic duct epithelial cell line HPDE6c-7 were purchased
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AGACAAAGACAGCAGGTTCC

Reverse

CGGCATACACTATACAGATGAC

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Qu, S, Hao, X, Song, W, Niu, K, Yang, X, Zhang, X, Shang, R, Wang, Q, Li, H, Liu, Z (2019). Circular RNA circRHOT1 is upregulated and promotes cell proliferation and invasion in pancreatic cancer. Epigenomics, 11, 1:53-63.