circRNA-000284
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseCervical CancerICD-10 Malignant neoplasm of cervix uteri (C53)
 DBLinkLink to databasePMID29511454
 Experimental Method
 Sample TypeHeLa, CaSki, SiHa, C-33A, SW756 Cell linesComparisonHuman cervical cancer cells and cervical normal epithelial cells
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TATGTTGGTGGATCCTGTTCGGCA

Reverse

TGGTGGGTAGACCAAGACTTGTGA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Ma, HB, Yao, YN, Yu, JJ, Chen, XX, Li, HF (2018). Extensive profiling of circular RNAs and the potential regulatory role of circRNA-000284 in cell proliferation and invasion of cervical cancer via sponging miR-506. Am J Transl Res, 10, 2:592-604.