circRNA-000911
 GeneIFNGR2OrganismHuman
 Genome Locuschr21:34797903:34797990:+Buildhg19
 DiseaseBreast CancerICD-10 Malignant neoplasm of breast (C50)
 DBLinkLink to databasePMID29431182
 Experimental Method
 Sample TypeTissuesComparisoncancer tissues and paired adjacent non-cancerous tissues
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AAAAGCAAGCAGTGCCCATA

Reverse

GCTCGAATCAGGTCCACCA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Wang, H, Xiao, Y, Wu, L, Ma, D (2018). Comprehensive circular RNA profiling reveals the regulatory role of the circRNA-000911/miR-449a pathway in breast carcinogenesis. Int. J. Oncol., 52, 3:743-754.