circRNA-010056
 GeneUbe3aOrganismMouse
 Genome Locusn/aBuildn/a
 DiseasePolarized macrophagesICD-10 n/a (n/a)
 DBLinkLink to databasePMID28075448
 Experimental Method
 Sample TypeTissuesComparisonBone Marrow Derived Macrophages (BMDMs) cultured with and without Macrophage polarization using Lipopolysaccharide
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

TCACCAGGAGAATCCCAGTCGAACTCTAAAATCAGGCT

Reverse

n/a

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhang, Y, Zhang, Y, Li, X, Zhang, M, Lv, K (2017). Microarray analysis of circular RNA expression patterns in polarized macrophages. Int. J. Mol. Med., 39, 2:373-379.