circRNA0003906
 Genen/aOrganismHuman
 Genome Locuschr6:29989443-30003760:n/aBuildhg19
 DiseaseColorectal CancerICD-10 Malignant neoplasm of rectosigmoid junction (C19)
 DBLinkLink to databasePMID29123417
 Experimental Method
 Sample TypeTissues and Cell linesComparison122 CRC tissues and matched nontumor tissues and Normal human colon epithelial cell line (NCM460) and six CRC cell lines (SW480, SW620, HCT8, HCT116, HT29, and LoVo)
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

TCTGGCAGACCAGGGGTTAC

Reverse

TGCCTTGCCGCCATCTTTTA

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Zhuo, F, Lin, H, Chen, Z, Huang, Z, Hu, J (2017). The expression profile and clinical significance of circRNA0003906 in colorectal cancer. Onco Targets Ther, 10:5187-5193.