circRNA8924
 Genen/aOrganismHuman
 Genome Locuschr1: 2072008388-207201024:n/aBuildhg19
 DiseaseCervical CancerICD-10 Malignant neoplasm of cervix uteri (C53)
 DBLinkLink to databasePMID30007986
 Experimental Method
 Sample TypeTissues and Cell linesComparisonCC tissues and adjacent normal tissues were collected from 33 cases of patients
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CAGCTGTGACAGCATGATGA

Reverse

TCGGGCATCACCCGAAACAA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Liu, J, Wang, D, Long, Z, Liu, J, Li, W (2018). CircRNA8924 Promotes Cervical Cancer Cell Proliferation, Migration and Invasion by Competitively Binding to MiR-518d-5p /519-5p Family and Modulating the Expression of CBX8. Cell. Physiol. Biochem., 48, 1:173-184.