circRNA_001569
 Genen/aOrganismHuman
 Genome Locusn/aBuildhg19
 DiseaseGastric CancerICD-10 Stomach, Malignant neoplasm of unspecified (C16.9)
 DBLinkLink to databasePMID30304349
 Experimental Method
 Sample TypeTissues and Cell linesComparisontumor tissues were obtained from the 30 patients, The normal tissues were the adjacent cancer tissues that collected from more than 5 cm away from the tumors tissues and Human gastric cancer cell lines SGC-7901 and MGC-803, human normal gastric mucosal cell line GES-1
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

CACCGCATTAACCATCGGGA

Reverse

GACTTGCGACTTACGACTCTA

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Shen, F., Liu, P., Li, N., Yi, Z., Tie, X., Zhang, Y., … Xu, Z. (2018). CircRNA_001569 promotes cell proliferation through absorbing miR-145 in gastric cancer. The Journal of Biochemistry. doi:10.1093/jb/mvy079