circRNA_004772/mm9_circ_004772
 GeneENOX1OrganismMouse
 Genome Locuschr14:77764832-77780495:+Buildn/a
 DiseaseNonalcoholic steatohepatitisICD-10 Other specified inflammatory liver diseases (K75.8)
 DBLinkLink to databasePMID27677588
 Experimental Method
 Sample TypeLiver TissuesComparisonnonalcoholic steatohepatitis (NASH) (n=12) and control (n=12)
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CAGGACTGAACCGCACGAG

Reverse

CAAGATCTCCCATCAGCAACC

StatisticsFold Change : Downregulated
pvalue : p<0.05
 Citation
Jin, X, Feng, CY, Xiang, Z, Chen, YP, Li, YM (2016). CircRNA expression pattern and circRNA-miRNA-mRNA network in the pathogenesis of nonalcoholic steatohepatitis. Oncotarget, 7, 41:66455-66467.